GeneGlobe ID: ZP00002544 | Cat. No.: 339350 | miRCURY LNA miRNA Probe PCR Assays

hsa-miR-92b-5p miRCURY LNA miRNA Probe PCR Assay

Product Specification

Pre-designed wet-lab verified qPCR assay.
Name​
hsa-miR-92b-5p (ZP00002544)
Species​
Human (Homo sapiens)
Wet-lab verified​
qPCR wet-lab verified
Targets (mature miR)
miRBase ID​
hsa-miR-92b-5p
miRBase Accession​
MIMAT0004792
Mature miRNA sequence​
AGGGACGGGACGCGGUGCAGUG
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-92b
miRBase Accession​
MI0003560
Description​
Homo sapiens miR-92b stem-loop
miRNA sequence (pre-miR)​
CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGUGCAGUGUUGUUUUUUCCCCCGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCCCGGCCC
miRNAs amplified by this miRCURY LNA Probe PCR Assay​
hsa-miR-92b-5p

Resources

Quick-Start Protocols (1)
Safety Data Sheets (1)
Kit Handbooks (2)
For highly sensitive, real-time RT-PCR detection of miRNAs using hydrolysis probes
For highly sensitive, ultrafast real-time RT-PCR detection of miRNAs from exosomes, serum/plasma, and other biofluids
Certificates of Analysis (1)
Introducing the hsa-miR-92b-5p miRCURY LNA miRNA Probe PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA Probe PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the hsa-miR-92b-5p miRCURY LNA miRNA Probe PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA Probe PCR Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with hsa-miR-92b-5p miRCURY LNA miRNA Probe PCR Assay and elevate your work to new heights.