GeneGlobe ID: YP02110633 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays

hsa-miR-4727-5p miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR. Wet-lab verified for qPCR.
Targets similar miRNAs across multiple species.
Name​
hsa-miR-4727-5p (YP02110633)
Species​
Human (Homo sapiens)
Wet-lab verified​
qPCR wet-lab verified
Targets (mature miR)
miRBase ID​
hsa-miR-4727-5p
miRBase Accession​
MIMAT0019847
Mature miRNA sequence​
AUCUGCCAGCUUCCACAGUGG
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-4727
miRBase Accession​
MI0017364
Description​
Homo sapiens miR-4727 stem-loop
miRNA sequence (pre-miR)​
AAUCUGCCAGCUUCCACAGUGGCAGAUUUUCCCAUAGUGGGAAGCUGGCAGAUUC
miRNAs amplified by this miRCURY LNA PCR Assay​
hsa-miR-4727-5p

Resources

Safety Data Sheets (1)
Kit Handbooks (3)
For highly sensitive detection of miRNA using EvaGreen
For highly sensitive, real-time RT-PCR detection of miRNAs using SYBR Green
Application Notes (1)
Here, we present a highly efficient, high-throughput workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, to accurately analyze miRNAs in well-defined individual cells and populations of cells.
Certificates of Analysis (1)
Introducing the hsa-miR-4727-5p miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the hsa-miR-4727-5p miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with hsa-miR-4727-5p miRCURY LNA miRNA PCR Assay and elevate your work to new heights.