GeneGlobe ID: YP00204779 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays

hsa-miR-136-5p miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR. Wet-lab verified for qPCR and dPCR.
Targets similar miRNAs across multiple species.
Name​
hsa-miR-136-5p (YP00204779)
Species​
Bornean orangutan (Pongo pygmaeus), Chimpanzee (Pan troglodytes), Cow (Bos taurus), Dog (Canis lupus familiaris), Domestic guinea pig (Cavia porcellus), Human (Homo sapiens), Nine-banded armadillo (Dasypus novemcinctus), Pig (Sus scrofa), Pteropus alecto (Pteropus alecto), Pygmy chimpanzee (Pan paniscus), Rabbit (Oryctolagus cuniculus), Rat (Rattus norvegicus), Rhesus macaque (Macaca mulatta), Sheep (Ovis aries), Tupaia chinensis (Tupaia chinensis), Western Gorilla (Gorilla gorilla)
Wet-lab verified​
qPCR and dPCR wet-lab verified
Targets (mature miR)
miRBase ID​
hsa-miR-136-5p
miRBase Accession​
MIMAT0000448
Mature miRNA sequence​
ACUCCAUUUGUUUUGAUGAUGGA
Alternative targets​
rno-miR-136-5p, cfa-miR-136, mml-miR-136, cpo-miR-136-5p, bta-miR-136, dno-miR-136-5p, ggo-miR-136, oar-miR-136, ocu-miR-136-5p, pal-miR-136-5p, ppa-miR-136, ppy-miR-136, ptr-miR-136, ssc-miR-136-5p, tch-miR-136-5p
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-136
miRBase Accession​
MI0000475
Description​
Homo sapiens miR-136 stem-loop
miRNA sequence (pre-miR)​
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCU
miRNAs amplified by this miRCURY LNA PCR Assay​
hsa-miR-136-5p

Resources

Safety Data Sheets (1)
Kit Handbooks (3)
For highly sensitive detection of miRNA using EvaGreen
For highly sensitive, real-time RT-PCR detection of miRNAs using SYBR Green
Application Notes (1)
Here, we present a highly efficient, high-throughput workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, to accurately analyze miRNAs in well-defined individual cells and populations of cells.
Certificates of Analysis (1)
Introducing the hsa-miR-136-5p miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Bornean orangutan models. Leveraging advanced technology, the hsa-miR-136-5p miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Bornean orangutan studies. Embrace the future of research with hsa-miR-136-5p miRCURY LNA miRNA PCR Assay and elevate your work to new heights.