GeneGlobe ID: DMA00414 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus

Product Specification

Bacterial detection assay targeting an intergenic spacer region
Alternative names of species: Mycobacterium abscessus
Product name​
Mycobacteroides abscessus
GeneGlobe Cat.No. (Assay ID)​
DMA00414
Target type​
Microbial Id
Target region​
Intergenic spacer region
Target (NCBI taxonomy ID)​
Mycobacteroides abscessus (36809)
Mycobacterium abscessus
Mycobacterium chelonae subsp. abscessus
Mycobacterium chelonei subsp. abscessus
Template accession​
KC352862.1
Taxonomy​
Bacteria
Application field​
Infectious Diseases
Multiple Drug Resistance
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GCGCGTCTGGCCTGGGGGCGTTGTTACCCAATCGATAGCACTGTGACAGAAGTGGCCAGTGTGAATCTTGATTAGAATGGCGTACGCGTGGCCGACCGGGGGAGAGATGCGGCCGGAGTGAGAAGGGCTGCTGGACATGAGGTCATCTGGGCGACGGA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Introducing the dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mycobacteroides abscessus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mycobacteroides abscessus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus and elevate your work to new heights.