dPCR CNV Probe Gene of Interest for RUNX3
GeneGlobe ID: DCG0000350 | Cat. No.: 250210 | dPCR CNV Probe Assays
Product Specification
Gene symbol: RUNX3
Ensembl Gene ID: ENSG00000020633
dPCR wet-lab validated
Ensembl Gene ID: ENSG00000020633
dPCR wet-lab validated
Product Name
dPCR CNV Probe Gene of Interest for RUNX3
GeneGlobe Cat.No. (Assay ID)
DCG0000350
Assay type
Gene of Interest
Species
Human (Homo sapiens)
Gene symbol
RUNX3
Ensembl Gene ID
ENSG00000020633
NCBI Gene Id
864
Strand
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length
71
Amplicon region
AGCACCCGACAAATGCCATATCTGAAAGCTTTCTCCATCCTTTTCCTTTCCTTGACTCCCTCAGTAGTCTCCATGGACAGTCATCTCCACTCCCAGCCTCC
Recommended Reference Assay
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme
CviQI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab verified
dPCR wet-lab verified
Hydrolysis Probe
FAM, ATTO550, Cy5, ATTO700
Primer Purification
Desalted
Probe Purification
HPLC
Reaction size
300rxns, 500rxns and 1000rxns depending on selected dye
Product Resources
File Size: 228.38 KBLanguage: English
Resources
Introducing the dPCR CNV Probe Gene of Interest for RUNX3, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for RUNX3 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for RUNX3 and elevate your work to new heights.