GeneGlobe ID: DCG0000021 | Cat. No.: 250210 | dPCR CNV Probe Assays
dPCR CNV Probe Gene of Interest for MSH6
Product Specification
Gene symbol: MSH6
Ensembl Gene ID: ENSG00000116062
dPCR wet-lab validated
Ensembl Gene ID: ENSG00000116062
dPCR wet-lab validated
Product Name
dPCR CNV Probe Gene of Interest for MSH6
GeneGlobe Cat.No. (Assay ID)
DCG0000021
Assay type
Gene of Interest
Species
Human (Homo sapiens)
Gene symbol
MSH6
Ensembl Gene ID
ENSG00000116062
NCBI Gene Id
2956
Strand
Binds to forward (5’ to 3’) top genome strand
Amplicon length
116
Amplicon region
ATGGAACAAATGGTTCTACTGAAGGAACCCTACTAGAGAGGGTTGATACTTGCCATACTCCTTTTGGTAAGCGGCTCCTAAAGCAATGGCTTTGTGCCCCACTCTGTAACCATTATGCTATTAATGATCGTCTAGATGCCATAGAA
Recommended Reference Assay
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated
dPCR wet-lab validated
Hydrolysis Probe
FAM, ATTO550, Cy5, ATTO700
Primer Purification
Desalted
Probe Purification
HPLC
Reaction size
300rxns, 500rxns and 1000rxns depending on selected dye
Product Resources
File Size: 229.72 KBLanguage: English
Resources
Available Product Catalog (2)
Kit Handbooks (2)
Application Notes (1)
Scientific Posters (1)
Quick-Start Protocols (1)
Brochures & Guides (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR CNV Probe Gene of Interest for MSH6, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for MSH6 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for MSH6 and elevate your work to new heights.