dPCR CNV Probe Gene of Interest for NIPA2

Product Specification

Gene symbol: NIPA2
Ensembl Gene ID: ENSG00000140157
dPCR wet-lab validated

Product Name

dPCR CNV Probe Gene of Interest for NIPA2

GeneGlobe Cat.No. (Assay ID)

DCG0000568

Assay type

Gene of Interest

Species

Human (Homo sapiens)

Gene symbol

NIPA2

Ensembl Gene ID

ENSG00000140157

NCBI Gene Id

81614

Strand

Binds to reverse (3’ to 5’) bottom genome strand

Amplicon length

105

Amplicon region

TTCTGTGTTTAAGAACAACCAACCATTTGACTCATGTAACTTTTCTTTGCCTCCTCCAGGTTTTGTGGTCTTTGCAACCCTTGTGGTCATTGTGGCCTTGATATTAATCTTCGTGGTGGGTCCTCGCCATGGACA

Recommended Reference Assay

TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)

Recommended Restriction Enzyme

CviQI, AluI, EcoRI, XbaI, PvuII

Wet-lab validated

dPCR wet-lab validated

Hydrolysis Probe

FAM, ATTO550, Cy5, ATTO700

Primer Purification

Desalted

Probe Purification

HPLC

Reaction size

300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

Validation Data

File Size: 225.01 KBLanguage: English

Resources

Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.

For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System

Introducing the dPCR CNV Probe Gene of Interest for NIPA2, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for NIPA2 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for NIPA2 and elevate your work to new heights.

Country and Language

Explore dPCR & qPCR assay portfolio

Unlock Deeper Insights with GeneGlobe Tutorials

dPCR CNV Probe Gene of Interest for NIPA2

Product Specification

Product Resources

Resources