GeneGlobe ID: DMA00471 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Pentatrichomonas hominis
Product Specification
Metamonada detection assay targeting the 18S ribosomal RNA gene
Product name
Pentatrichomonas hominis
GeneGlobe Cat.No. (Assay ID)
DMA00471
Target type
Microbial Id
Target region
18S ribosomal RNA gene
Target (NCBI taxonomy ID)
Pentatrichomonas hominis (5728)
Template accession
HQ149970.1
Taxonomy
Invertebrates
Secondary targets/specificity
Trichomitopsis parvus (1312422)
Tetratrichomonas buttreyi (321954)
Tetratrichomonas buttreyi (321954)
Application field
Human Microbiome
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TGGTAACAAGAATGACTCAGCGCAGTATGAAGTCTTTGTTTCTTTCGGGAAACAAGCTCAATGAGAGCCATCGGGGGTGGATCTATTTCATGGCGAGTGGTGGAATACTTTGACCCATGAGAGAGACACGGAGGCGAAGGCGTCCACCTAGAGGGTTTCTGTCGATCAAGGGCGAGAGTAGGAGTA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pentatrichomonas hominis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pentatrichomonas hominis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pentatrichomonas hominis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pentatrichomonas hominis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pentatrichomonas hominis and elevate your work to new heights.