GeneGlobe ID: DMA00473 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Norovirus GII
Product Specification
Viral detection assay targeting the nonstructural protein gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Norovirus GII
GeneGlobe Cat.No. (Assay ID)
DMA00473
Target type
Microbial Id
Target region
Nonstructural protein gene
Target (NCBI taxonomy ID)
Norovirus GII (122929)
human calicivirus genogroup 2
Norovirus genogroup 2
Norovirus genogroup II
Norwalk-like viruses genogroup 2
Norwalk-like virus genogroup 2
human calicivirus genogroup 2
Norovirus genogroup 2
Norovirus genogroup II
Norwalk-like viruses genogroup 2
Norwalk-like virus genogroup 2
Template accession
JX439904.1
Taxonomy
Viruses
Secondary targets/specificity
Caliciviridae (11974)
Hawaii calicivirus (33750)
Hawaii virus
Minireovirus (194422)
Camberwell virus (94433)
Hawaii calicivirus (33750)
Hawaii virus
Minireovirus (194422)
Camberwell virus (94433)
Application field
Human Pathogens
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
CCCAGACAAGAGCCAATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGGTCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGAGTGACGCCAACCCAT
Reaction size
200rxns
Product Resources
File Size: 191.86 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Norovirus GII, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Caliciviridae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Norovirus GII facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Caliciviridae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Norovirus GII and elevate your work to new heights.