GeneGlobe ID: DMA00398 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Aspergillus flavus (2)

Product Specification

Fungal detection assay targeting ITS1 and 5.8S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Aspergillus flavus (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00398
Target type​
Microbial Id
Target region​
ITS1 and 5.8S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Aspergillus flavus (5059)
Aspergillus flavus var. parvisclerotigenus
Aspergillus parvisclerotigenus
Petromyces flavus
Template accession​
GU594735.1
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Aspergillus aflatoxiformans (2059437)
Aspergillus oryzae (5062)
Aspergillus flavus var. oryzae
Application field​
Environmental Microbes
Food Production
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TCCTAGCGAGCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 229.29 KBLanguage: English

Resources

Available Product Catalog (2)
기술 정보 (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
키트 안내서 (1)
브로셔 및 가이드 (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Introducing the dPCR Microbial DNA Detection Assay for Aspergillus flavus (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Aspergillus aflatoxiformans models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Aspergillus flavus (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Aspergillus aflatoxiformans studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Aspergillus flavus (2) and elevate your work to new heights.