GeneGlobe ID: DMA00299 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Sphingomonas paucimobilis

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Sphingomonas paucimobilis
GeneGlobe Cat.No. (Assay ID)​
DMA00299
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Sphingomonas paucimobilis (13689)
Bacillus devorans
Chromobacterium devorans
Flavobacterium devorans
Pseudomonas paucimobilis
Template accession​
D16144.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Sphingomonas sanguinis (33051)
Sphingomonas pseudosanguinis (413712)
Sphingomonas yabuuchiae (172044)
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GAATCTGCCCTTAGGTTCGGAATAACAGCTGGAAACGGCTGCTAATACCGGATGATATCGCGAGATCAAAGATTTATCGCCTGAGGATGAGCCCGCGTTGGATTAGGTAGTTGGTGGGGTAAAGGCCTACCAAGCCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTACCCGGGAAGATAATGACTGTACCGGGAGA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Sphingomonas paucimobilis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Sphingomonas paucimobilis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Sphingomonas paucimobilis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Sphingomonas paucimobilis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Sphingomonas paucimobilis and elevate your work to new heights.