id | dme-mir-316 |
Accession | MI0000428 |
Comments | Lai et al. predicted this sequence based on conservation in D. pseudoobscura, but did not verify expression [2]. Aravin et al. describe identification and mapping of the 5' end of the excised sequence by cloning [1]. |
Database Links | dme-mir-316 |
Description | Drosophila melanogaster miR-316 stem-loop |
Gene Family | MIPF0000254;mir-316 |
Genome Context | chr3L: 21668714-21668802 [-] |
miRna Matures Links | |
Sequence | AAAUUCUAGUCGAUUUGUCUUUUUCCGCUUACUGGCGUUUCAAUUCCACAACGACAGGAAAGGGAAAAAGGCGUAUUUACUAUGAGUUU |