Stem-loop rno-mir-32
Mirna Stemloop Summary
| id | rno-mir-32 |
| Accession | MI0000873 |
| Comments | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. |
| Database Links | rno-mir-32 |
| Description | Rattus norvegicus miR-32 stem-loop |
| Gene Family | MIPF0000069;mir-32 |
| Genome Context | chr5: 73934255-73934324 [-] |
| miRna Matures Links | |
| Sequence | GGGGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUCUC |