Stem-loop rno-mir-139
Mirna Stemloop Summary
| id | rno-mir-139 |
| Accession | MI0000913 |
| Comments | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. |
| Database Links | rno-mir-139 |
| Description | Rattus norvegicus miR-139 stem-loop |
| Gene Family | MIPF0000117;mir-139 |
| Genome Context | chr1: 166589545-166589612 [+] |
| miRna Matures Links | |
| Sequence | GUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCUGGAGACGCGGCCCUGUUGGAGUAAC |