GeneGlobe ID: DMA00165 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Haemophilus influenzae
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Haemophilus influenzae
GeneGlobe Cat.No. (Assay ID)
DMA00165
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Haemophilus influenzae (727)
Bacterium influenzae
Coccobacillus pfeifferi
Haemophilus meningitidis
Influenza-bacillus
Mycobacterium influenzae
Bacterium influenzae
Coccobacillus pfeifferi
Haemophilus meningitidis
Influenza-bacillus
Mycobacterium influenzae
Template accession
AY613709.1
Taxonomy
Bacteria
Secondary targets/specificity
Haemophilus haemolyticus (726)
Bacillus X
Bacillus X
Application field
Human Microbiome
Infectious Diseases
Sepsis
Infectious Diseases
Sepsis
Wet-lab tested in singleplex
Yes, tested dye - ROX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GGGAAACTGTCGCTAATACCGCGTATTATCGGAAGATGAAAGTGCGGGACTGAGAGGCCGCATGCCATAGGATGAGCCCAAGTGGGATTAGGTAGTTGGT
Reaction size
200rxns
Product Resources
File Size: 201.53 KBLanguage: English
Resources
Available Product Catalog (2)
빠른 시작 프로토콜 (1)
애플리케이션 노트 (2)
기술 정보 (1)
키트 안내서 (1)
과학 포스터 (1)
브로셔 및 가이드 (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Application Notes (2)
Scientific Posters (1)
Technical Information (1)
Kit Handbooks (1)
Quick-Start Protocols (1)
Introducing the dPCR Microbial DNA Detection Assay for Haemophilus influenzae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Haemophilus haemolyticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Haemophilus influenzae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Haemophilus haemolyticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Haemophilus influenzae and elevate your work to new heights.