GeneGlobe ID: DMA00021 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Aeromonas veronii

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Aeromonas veronii
GeneGlobe Cat.No. (Assay ID)​
DMA00021
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Aeromonas veronii (654)
Aeromonas culicicola
Aeromonas hybridization group 10 (HG10)
Aeromonas ichthiosmia
Enteric Group 77
Template accession​
AB472971.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Aeromonas sobria (646)
Aeromonas hybridization group 7 (HG7)
Aeromonas hydrophila (644)
Aeromonas dourgesi
Aeromonas hydrophila (Chester 1901) Stanier 1943 (Approved Lists 1980)
Aeromonas liquefaciens
Bacillus hydrophilus fuscus
Bacterium hydrophilum
Proteus hydrophilus
Proteus ichthyosmius
Pseudomonas hydrophila
Application field​
Gastrointestinal Infections
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CTTCGGGCCTTGCGCGATTGGATGAACCCAGGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGTTGGTAGCTAATAACTGCCAGCTGTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Aeromonas veronii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Aeromonas hydrophila models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Aeromonas veronii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Aeromonas hydrophila studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Aeromonas veronii and elevate your work to new heights.