GeneGlobe ID: DMA00728 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 3 (2)

Product Specification

Viral detection assay targeting ORF38
Alternative names of species: VZV, HHV-3, Human herpes virus 3
dPCR wet-lab validated
Product name​
Human alphaherpesvirus 3 (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00728
Target type​
Microbial Id
Target region​
ORF38
Target (NCBI taxonomy ID)​
Human alphaherpesvirus 3 (10335)
HHV-3
Human herpes virus 3
Human herpesvirus 3
Varicella Zoster Virus
Varicella-zoster virus
varicella zoster virus VZV
varicella-zoster virus VZV
VZV
hhv-3vzv
Template accession​
NC_001348
Taxonomy​
Viruses
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
ATGCCCGAAAAATGGAAGTTCCCCCCGTTCGCCATATACCGCAACAACTGCAGTATATATCGTCTCACGGGCTTCATTAAGTTCATCTTCAAGTCCAGGCCATTTTCTGGCT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 109.12 KBLanguage: English

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 3 (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human alphaherpesvirus 1 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 3 (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human alphaherpesvirus 1 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 3 (2) and elevate your work to new heights.