GeneGlobe ID: DMA00721 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Bacteroides HF183 Cluster

Product Specification

Bacterial detection assay
Alternative names of species: HF183
dPCR wet-lab validated
Product name​
Bacteroides HF183 Cluster
GeneGlobe Cat.No. (Assay ID)​
DMA00721
Target type​
Microbial Id
Target region​
Bacteroides 16S ribosomal RNA gene (HF183)
Target (NCBI taxonomy ID)​
Bacteroides (816)
Capsularis
Ristella
Taxonomy​
Bacteria
Application field​
Positive Control Assay
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CCAGGATGGGATCATGAGTTCACATGTCCGCATGATTAAAGGTATTTTCCGGTAGACGATGGGGATGCGTTCCATTAGATAGTAGGCGGGGTAACGGCCCACCTAGTCAACGATGGATAGGGGTTCTGAGAGGAAGG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 92.56 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Bacteroides HF183 Cluster, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Bacteroides models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Bacteroides HF183 Cluster facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Bacteroides studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Bacteroides HF183 Cluster and elevate your work to new heights.