id | hsa-mir-147a |
Accession | MI0000262 |
Comments | Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue [1], but the sequence is not present in the mouse genome assembly (NCBI32). The human genome sequence contains a predicted precursor hairpin for miR-147 shown in [1] (supplementary information) and represented here. The expression of miR-147 has not been verified in human. |
Database Links | hsa-mir-147a |
Description | Homo sapiens miR-147a stem-loop |
Gene Family | MIPF0000105;mir-147 |
Genome Context | chr9: 120244979-120245050 [-] |
miRna Matures Links | |
Sequence | AAUCUAAAGACAACAUUUCUGCACACACACCAGACUAUGGAAGCCAGUGUGUGGAAAUGCUUCUGCUAGAUU |