id | rno-mir-352 |
Accession | MI0000644 |
Comments | Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. miR-352 is closely related to let-7d (a single deletion), but the predicted hairpin precursor sequences are unrelated, and express their mature forms from opposite strands. |
Database Links | rno-mir-352 |
Description | Rattus norvegicus miR-352 stem-loop |
Genome Context | : 0-0 [] |
miRna Matures Links | |
Sequence | GUACAUAUGUUGAAGAUUAUUAAUAUAUAGAGUGGGUGUUGUGGUGGUAGUAUGAUAUGUAGAGUAGUAGGUUGCAUAGUACGAUGUAGUGUAUGA |