Stem-loop ath-MIR398a
Mirna Stemloop Summary
| id | ath-MIR398a |
| Accession | MI0001017 |
| Comments | This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1]. |
| Database Links | ath-MIR398a |
| Description | Arabidopsis thaliana miR398a stem-loop |
| Gene Family | MIPF0000107;MIR398 |
| Genome Context | chr2: 1040938-1041042 [+] |
| miRna Matures Links | |
| Sequence | UGAAAUUUCAAAGGAGUGGCAUGUGAACACAUAUCCUAUGGUUUCUUCAAAUUUCCAUUGAAACCAUUGAGUUUUGUGUUCUCAGGUCACCCCUUUGAAUCUCCC |