The following mature miRNA have the same seed sequence: UCAACGG
| ID | hsa-miR-95-3p |
| Accession | MIMAT0000094 |
| Sequence | 49 - UUCAACGGGUAUUUAUUGAGCA - 70 |
| Seed Sequence | UCAACGG |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulates
regulated by
- insulin
- sirolimus
disease
- pancreatic cancer
- colorectal cancer
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
- myelodysplastic syndrome with isolated del(5q)