The following mature miRNA have the same seed sequence: UCCGCUC
| ID | hsa-miR-572 |
| Accession | MIMAT0003237 |
| Sequence | 61 - GUCCGCUCGGCGGUGGCCCA - 80 |
| Seed Sequence | UCCGCUC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- nonobstructive azoospermia
- infiltrating ductal breast carcinoma
- invasive ductal breast cancer
- atypical hyperplasia