The following mature miRNA have the same seed sequence: UGGAGAU
| ID | hsa-miR-620 |
| Accession | MIMAT0003289 |
| Sequence | 61 - AUGGAGAUAGAUAUAGAAAU - 80 |
| Seed Sequence | UGGAGAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- postmenopausal osteoporosis
- renal clear cell adenocarcinoma
- renal clear cell cancer