The following mature miRNA have the same seed sequence: UUAGGAU
| ID | hsa-miR-651-5p |
| Accession | MIMAT0003321 |
| Sequence | 16 - UUUAGGAUAAGCUUGACUUUUG - 37 |
| Seed Sequence | UUAGGAU |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
disease
- intrahepatic cholestasis of pregnancy
- nonobstructive azoospermia
- HER2 negative hormone receptor negative breast cancer