The following mature miRNA have the same seed sequence: CCCACGU
| ID | hsa-miR-662 |
| Accession | MIMAT0003325 |
| Sequence | 61 - UCCCACGUUGUGGCCCAGCAG - 81 |
| Seed Sequence | CCCACGU |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- human herpesvirus 8
disease
- lupus nephritis