The following mature miRNA have the same seed sequence: GGGUGGA
| ID | hsa-miR-363-5p |
| Accession | MIMAT0003385 |
| Sequence | 7 - CGGGUGGAUCACGAUGCAAUUU - 28 |
| Seed Sequence | GGGUGGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
regulated by
- bortezomib
- perifosine
disease
- non-insulin-dependent diabetes mellitus
- Waldenström macroglobulinemia
- nonobstructive azoospermia