The following mature miRNA have the same seed sequence: AAUCUCU
| ID | hsa-miR-216b-5p |
| Accession | MIMAT0004959 |
| Sequence | 11 - AAAUCUCUGCAGGCAAAUGUGA - 32 |
| Seed Sequence | AAUCUCU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- nonobstructive azoospermia
- postmenopausal osteoporosis
role in cell
- apoptosis
- cell viability
- motility