The following mature miRNA have the same seed sequence: GUCUACU
| ID | hsa-miR-934 |
| Accession | MIMAT0004977 |
| Sequence | 15 - UGUCUACUACUGGAGACACUGG - 36 |
| Seed Sequence | GUCUACU |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulates
disease
- epithelial cancer
- renal clear cell adenocarcinoma
- renal clear cell cancer
- HER2 negative hormone receptor negative breast cancer
- malignant mesothelioma
- mesothelioma formation
role in cell
- migration
- expression in