The following mature miRNA have the same seed sequence: CAGGACA
| ID | hsa-miR-4436a |
| Accession | MIMAT0018952 |
| Sequence | 56 - GCAGGACAGGCAGAAGUGGAU - 76 |
| Seed Sequence | CAGGACA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulates
disease
- idiopathic pulmonary fibrosis
- renal clear cell adenocarcinoma
- renal clear cell cancer
role in cell
- migration
- expression in