The following mature miRNA have the same seed sequence: CUAAGGA
| ID | hsa-miR-4521 |
| Accession | MIMAT0019058 |
| Sequence | 4 - GCUAAGGAAGUCCUGUGCUCAG - 25 |
| Seed Sequence | CUAAGGA |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- butein
disease
- chronic lymphocytic leukemia
- colon adenoma
- colon adenoma formation
- lung cancer