The following mature miRNA have the same seed sequence: AGGCCAC
| ID | hsa-miR-4717-5p |
| Accession | MIMAT0019829 |
| Sequence | 10 - UAGGCCACAGCCACCCAUGUGU - 31 |
| Seed Sequence | AGGCCAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulates
role in cell
- expression in
- cytarabine resistance
- gemcitabine resistance