The following mature miRNA have the same seed sequence: GAGACUG
| ID | hsa-miR-873-3p |
| Accession | MIMAT0022717 |
| Sequence | 46 - GGAGACUGAUGAGUUCCCGGGA - 67 |
| Seed Sequence | GAGACUG |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- MirBART2
disease
- vulvar melanoma
- vulva cancer