GeneGlobe ID: PM00028980 | Cat. No.: 978746 | PyroMark CpG Assays

Hs_TRIM50_01_PM PyroMark CpG assay

Product Specification

(ENSG00000146755, ENSG00000077800). PCR and sequencing primers for Pyrosequencing analysis of gene-specific CpG methylation after DNA bisulfite conversion (200 reactions; tube format)

null
GeneGlobe Id​
PM00028980
Name​
Hs_TRIM50_01_PM PyroMark CpG assay
Entrez genes for​
ENSG00000077800
Official Name​
FK506 binding protein 6, 36kDa
Official Symbol​
FKBP6
Species​
Human (Homo sapiens)
Entrez Gene ID​
8468
Transcript(s) for this gene​
NM_001135211 (1549), NM_003602 (1640), NM_001281304 (1550), XM_005250643 (1443), XM_006716152 (1548), XM_006716153 (1411), ENST00000437013, ENST00000252037, ENST00000413573, ENST00000431982
Entrez genes for​
ENSG00000146755
Official Name​
tripartite motif containing 50
Official Symbol​
TRIM50
Species​
Human (Homo sapiens)
Entrez Gene ID​
135892
Transcript(s) for this gene​
NM_178125 (2050), NM_001281450 (2047), NM_001281451 (1978), ENST00000493498, ENST00000333149, ENST00000453152
Additional information for this product
Amplicon Length​
213 bp
Sequenced Strand​
antisense
Biotin Modification on 1
reverse PCR primer
Chromosomal Location GRCh37 2
Chromosome 7, BP 727419XX-727418XX
Chromosomal Location GRCh38 2
Chromosome 7, BP 733279XX-733278XX
Sequence to Analyze​
AGGGGCCGGAGGCTGGGTACGTAACGAGAGCGAGCGGGA
Sequence After Bisulfite Treatment​
AGGGGTYGGAGGTTGGGTAYGTAAYGAGAGYGAGYGGGA
Number of CpG sites included​
5
Nucleotide dispensation order 3
TAGGTCGAGTCTAGTGATCGATATCGAGAGTCGAGTCG

Important: PyroMark CpG Assays include a downloadable Assay Setup file. This file contains all necessary setup data including nucleotide dispensation order and assay-specific settings for efficient data analysis. Designed for use with PyroMark Q24 Software 2.0, PyroMark Q24 Advanced Software, PyroMark Q96ID software version 2.5., and PyroMark CpG Software, Assay Setup files are continually updated with new information that improve the performance of the assay. Therefore, we strongly recommend downloading the Assay Setup file when purchasing a new PyroMark CpG Assay, and routinely checking for the latest version when running or reordering a PyroMark CpG Assay. To use the Assay Setup file, simply download and save it to a preferred folder on your computer. Open your software and add the folder with the Assay Setup file as a shortcut folder in the tree view.

With the nucleotide dispensation order it is possible to manually set up the Assay file needed. For your convenience however, we make available Assay setup files for PyroMark Q24 Software 2.0 (if using the PyroMark Q24), PyroMark Q24 Advanced Software (if using the PyroMark Q24 Advanced), and PyroMark Q96ID software version 2.5 (if using PyroMark Q96 ID), and PyroMark CpG Software (if using the PyroMark Q96 ID or PyroMark Q96 MD). Simply download the needed Assay setup file that corresponds to your system and save it to a preferred folder. Open your software and add the folder with the Assay setup file as a shortcut folder in the tree view.

1 The specific range of bases within a chromosome that is sequenced and analyzed with a given assay. This range is determined by the placement of the sequencing primer and the nucleotide dispensation order. The sequence begins at the first nucleotide after the sequencing primer and ends at the last nucleotide included in the "Sequence to analyze".

2 The chromosomal location is the precise location in the human genome of the sequence that will be analyzed by the assay. "ChrX" indicates chromosome number. The numbers that follow are the location on that chromosome of the first and last bases of the sequence that will be analyzed by the assay.

3 Defines the nucleotides and the order in which these are added to a reaction during the Pyrosequencing run. This sequence is included in the Assay Setup file provided with each assay. We recommend to always download the latest Assay Setup file prior to running a PyroMark CpG assay.

Product Resources

icon_0041_download-s PyroMark Assay setup file
File Size: 2.72 KBLanguage: English

Resources

seo_BottomDescription