Hs_ZC3H11A_01_PM PyroMark CpG assay

GeneGlobe ID: PM00000336 | Cat. No.: 978746 | PyroMark Q48 Autoprep: Instrument, reagents and accessories

Product Specification

(ENSG00000058673). PCR and sequencing primers for Pyrosequencing analysis of gene-specific CpG methylation after DNA bisulfite conversion (200 reactions; tube format)

null
GeneGlobe Id​
PM00000336
Name​
Hs_ZC3H11A_01_PM PyroMark CpG assay
Entrez genes for​
ENSG00000058673
Official Name​
zinc finger CCCH-type containing 11A
Official Symbol​
ZC3H11A
Species​
Human (Homo sapiens)
Entrez Gene ID​
9877
Transcript(s) for this gene​
NM_014827 (4795), XM_005245643 (4879), XM_005245644 (4563), XM_005245646 (3373), XM_006711673 (4726), NM_001319238 (5310), NM_001319239 (5205), XM_011510199 (5933), XM_011510200 (4953), XM_011510201 (5139), XM_011510202 (4878), XM_011510203 (4779), XM_011510204 (5256), ENST00000492823, ENST00000332127, ENST00000367210, ENST00000367212, ENST00000367214, ENST00000545588
Additional information for this product
Amplicon Length​
242 bp
Sequenced Strand​
sense
Biotin Modification on 1
reverse PCR primer
Chromosomal Location GRCh37 2
Chromosome 1, BP 2037647XX-2037647XX
Chromosomal Location GRCh38 2
Chromosome 1, BP 2037955XX-2037956XX
Sequence to Analyze​
TCCTCGCGCCCTGCGTCGTGCTGGCACTTTTACCGGCCGGGC
Sequence After Bisulfite Treatment​
TTTTYGYGTTTTGYGTYGTGTTGGTATTTTTATYGGTYGGGT
Number of CpG sites included​
6
Nucleotide dispensation order 3
ATTCGTCGATTGTCGTCGTAGTCTGTAGTTATCGTCG

Important: PyroMark CpG Assays include a downloadable Assay Setup file. This file contains all necessary setup data including nucleotide dispensation order and assay-specific settings for efficient data analysis. Designed for use with PyroMark Q24 Software 2.0, PyroMark Q24 Advanced Software, PyroMark Q96ID software version 2.5., and PyroMark CpG Software, Assay Setup files are continually updated with new information that improve the performance of the assay. Therefore, we strongly recommend downloading the Assay Setup file when purchasing a new PyroMark CpG Assay, and routinely checking for the latest version when running or reordering a PyroMark CpG Assay. To use the Assay Setup file, simply download and save it to a preferred folder on your computer. Open your software and add the folder with the Assay Setup file as a shortcut folder in the tree view.

With the nucleotide dispensation order it is possible to manually set up the Assay file needed. For your convenience however, we make available Assay setup files for PyroMark Q24 Software 2.0 (if using the PyroMark Q24), PyroMark Q24 Advanced Software (if using the PyroMark Q24 Advanced), and PyroMark Q96ID software version 2.5 (if using PyroMark Q96 ID), and PyroMark CpG Software (if using the PyroMark Q96 ID or PyroMark Q96 MD). Simply download the needed Assay setup file that corresponds to your system and save it to a preferred folder. Open your software and add the folder with the Assay setup file as a shortcut folder in the tree view.

1 The specific range of bases within a chromosome that is sequenced and analyzed with a given assay. This range is determined by the placement of the sequencing primer and the nucleotide dispensation order. The sequence begins at the first nucleotide after the sequencing primer and ends at the last nucleotide included in the "Sequence to analyze".

2 The chromosomal location is the precise location in the genome of the sequence that will be analyzed by the assay. "ChrX" indicates chromosome number. The numbers that follow are the location on that chromosome of the first and last bases of the sequence that will be analyzed by the assay.

3 Defines the nucleotides and the order in which these are added to a reaction during the Pyrosequencing run. This sequence is included in the Assay Setup file provided with each assay. We recommend to always download the latest Assay Setup file prior to running a PyroMark CpG assay.

Product Resources

icon_0041_download-s PyroMark Assay setup file
File Size: 2.81 KBLanguage: English

Resources

Software Release Notes (1)
Brochures & Guides (2)
Automated Pyrosequencing with integrated template preparation for advanced methylation, mutation and SNP quantification
Kit Handbooks (10)
Shortage of PyroMark Q48 Autoprep Absorber Strips
For use with PyroMark Q48 Autoprep, PyroMark Q24 Advanced, PyroMark Q24, PyroMark Q96 ID and PyroMark Q96 MD systems
For use with PyroMark Q24 Advanced, PyroMark Q24, PyroMark Q96 ID and PyroMark Q96 MD systems
For quantification of methylation level of the MLH1 gene using PyroMark Q24, PyroMark Q24 Advanced, and PyroMark Q48 Autoprep
For quantification of methylation level of the MGMT gene using PyroMark Q24, PyroMark Q24 Advanced, and PyroMark Q48 Autoprep
パイロシークエンス(Pyrosequencing)解析用に至適化された感度と精度の高い1 ステップRT-PCR
Safety Data Sheets (1)
Instrument User Manuals (2)

Version 1.1

Comprehensive guide to using the PyroMark Q48 Autoprep System for automated pyrosequencing. Covers installation, assay setup, maintenance, and data analysis workflows.

Version 1.0
Operating Software (3)
PyroMark Assay Design Software version 2.0.2 is compatible with Windows 7, Windows 10, and Windows 11 (64 bit) operating systems. This software may only be downloaded by registered users with a valid PyroMark Assay Design Software license. If you do not have a valid software license, contact your QIAGEN sales representative.

This is the latest version of the PyroMark Q48 Autoprep instrument software. The software may only be downloaded by registered users with a registered PyroMark Q48 Autoprep instrument. Follow the instructions provided in the user manual chapter 5.4 Upgrading the instrument software when updating the software. The user manual can be downloaded from the PyroMark Q48 Autoprep webpage.

SHA256 checksum: C0CAACC50A0E01E661983FEAE746C7C89735AD3FEC92C9B0351F7CF5DF8D40CA

PyroMark Q48 Autoprep Software version 2.4.2 is compatible with Windows 7, Windows 10, and Windows 11 (64 bit) operating systems. This software may only be downloaded by registered users with a valid PyroMark Q48 Autoprep Software license and registered PyroMark Q48 Autoprep instrument. If you do not have a valid software license, contact your QIAGEN Technical Services.

SHA256 checksum: D00C2CC40677D00EF4FCEF4ADBC9F57FFAEAC4E986115078BC6CCCB29A55EE36

 

Technical Information (1)
Certificates of Analysis (1)
Introducing the Hs_ZC3H11A_01_PM PyroMark CpG assay, a cutting-edge addition to our PyroMark Q48 Autoprep: Instrument, reagents and accessories lineup, specifically designed for Epigenetics applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the Hs_ZC3H11A_01_PM PyroMark CpG assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Epigenetics, or any other sophisticated analyses, this product from our PyroMark Q48 Autoprep: Instrument, reagents and accessories collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with Hs_ZC3H11A_01_PM PyroMark CpG assay and elevate your work to new heights.