dPCR Microbial DNA Detection Assay for Mucor hiemalis

GeneGlobe ID: DMA00368 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Fungal detection assay targeting the 18S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Mucor hiemalis
GeneGlobe Cat.No. (Assay ID)​
DMA00368
Target type​
Microbial Id
Target region​
18S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Mucor hiemalis (64493)
Mucor sp. heimalis
Template accession​
JQ912672.1
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Amylomyces rouxii (29923)
Mucor rouxii
Mucor irregularis (713888)
Mucor irregularis Stchigel, Cano, Guarro & Alvarez, 2011, nom. nov.
Rhizomucor variabilis R.Y. Zheng & G.Q. Chen, 1991
Application field​
Food Production
Fermentation and Degradation
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GTACACACCGCCCGTCGCTACTACCGATTGAATGGTTATAGTGAGCATATGGGATCAGTAGGATTAAACTGGCAACAGTTTTTCCCTGCAGAGAACTATGGCAAACTAGGCTATTTAGAGGAAGT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 201.47 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
seo_BottomDescription