dPCR Microbial DNA Detection Assay for Scardovia wiggsiae
GeneGlobe ID: DMA00399 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the heat shock protein 60 gene
Product name
Scardovia wiggsiae
GeneGlobe Cat.No. (Assay ID)
DMA00399
Target type
Microbial Id
Target region
Heat shock protein 60 gene
Target (NCBI taxonomy ID)
Scardovia wiggsiae (230143)
Scardovia genomosp. C1
Scardovia genomospecies C1
Scardovia genomosp. C1
Scardovia genomospecies C1
Template accession
GU301689.1
Taxonomy
Bacteria
Application field
Infectious Diseases
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
PvuII
Template present in Microbial DNA Positive Control
Yes
Region of Interest
ATAAAGTTGGGCAGGACGGTGTTGTTACTGTAGAAGATAATAACAAGTTCGGCCTTGACCTCGAATTCACTGAGGGTATGCGCTTCGACAAGGGTTATATTTCCCCCTATTTCGTCACCAATCCGGATGACCAGA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Scardovia wiggsiae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Scardovia wiggsiae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Scardovia wiggsiae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Scardovia wiggsiae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Scardovia wiggsiae and elevate your work to new heights.