dPCR Microbial DNA Detection Assay for ail

GeneGlobe ID: DMA00598 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Virulence gene detection assay targeting the bacterial attachment invasion locus protein gene
Product name​
ail
GeneGlobe Cat.No. (Assay ID)​
DMA00598
Target type​
Virulence
Target region​
Bacterial attachment invasion locus protein gene
Target (NCBI taxonomy ID)​
attachment invasion locus protein
Template accession​
CP001593.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ACTGCGGGGCCTGTTTTCCGCATTAACGAGTATGTTAGCTTGTATGGATTATTGGGGGCAGGTCATGGAAAGGCTAAATTTTCCTCAATATTTGGTCAATCAGAGAGTAGAAGTAAAACATCTCTGGCATACGGTGCCGGATTACAATTTAATCCACATCCAAATTTTGTCATTGATGCTTCATATGAATACTCCAAACTCGATGATGTGAAAGTGGGTACTTGGATGCTT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for ail, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with attachment invasion locus protein models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for ail facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for attachment invasion locus protein studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for ail and elevate your work to new heights.