dPCR Microbial DNA Detection Assay for Serratia marcescens

GeneGlobe ID: DMA00749 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
Alternative names of species: S. marcescens; Bacillus marcescens
dPCR wet-lab verified
Product name​
Serratia marcescens
GeneGlobe Cat.No. (Assay ID)​
DMA00749
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Serratia marcescens (615)
Bacillus marcescens
Serratia marcescens subsp. marcescens
Serratia marcescens subsp. sakuensis
Template accession​
 AJ233431
Taxonomy​
Bacteria
Secondary targets/specificity​
Serratia nematodiphila (458197)
Serratia rubidaea (61652)
Serratia marinorubra
Application field​
Urinary Tract Infections
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AGCGAGGAGGAAGGTGGTGAGCTTAATACGTTCATCAATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGAAACTGGCAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 95.74 KBLanguage: English

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Serratia marcescens, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Serratia nematodiphila models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Serratia marcescens facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Serratia nematodiphila studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Serratia marcescens and elevate your work to new heights.