dPCR Microbial DNA Detection Assay for Tyzzerella nexilis

GeneGlobe ID: DMA00108 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Alternative names of species: Clostridium nexile
Product name​
Tyzzerella nexilis
GeneGlobe Cat.No. (Assay ID)​
DMA00108
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
[Clostridium] nexile (29361)
Clostridium nexile
Tyzzerella nexilis
Template accession​
AY169415.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Dorea formicigenerans (39486)
Eubacterium formicigenerans
Roseburia faecis (301302)
Agathobacter faecis
[Ruminococcus] torques (33039)
Mediterraneibacter torques
Ruminococcus torques
Blautia obeum (40520)
Ruminococcus obeum
[Clostridium] hylemonae (89153)
Clostridium hylemonae
Coprococcus comes (410072)
Mediterraneibacter gnavus (33038)
Mediterraneibacter gnavus (Moore et al. 1976) Togo et al. 2023
Ruminococcus gnavus
Application field​
Human Microbiome
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CCCTGGTAGTCCACGCCGTAAACGATGACTACTAGGTGTCGGGGAGCAAAGCTCTTCGGTGCCGCAGCAAACGCAATAAGTAGTCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCTGCTCTTGACATCCCGGTGACCGGCGTGTAATGACGCC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Tyzzerella nexilis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with [Clostridium] nexile models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Tyzzerella nexilis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for [Clostridium] nexile studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Tyzzerella nexilis and elevate your work to new heights.