GeneGlobe ID: DMA00469 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Entamoeba coli
Product Specification
Amoebozoa detection assay targeting the 18S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Entamoeba coli
GeneGlobe Cat.No. (Assay ID)
DMA00469
Target type
Microbial Id
Target region
18S ribosomal RNA gene
Target (NCBI taxonomy ID)
Entamoeba coli (110766)
Template accession
AB851499.1
Taxonomy
Invertebrates
Secondary targets/specificity
Entamoeba coli (110766)
Application field
Environmental Microbes
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - ROX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GACTTCAGGGGGAGTATGGTCACAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCAAGACCGAACGGTGTAAGGAATGACAGGTTACTGGATTTTTCATGATTCATCGGGGAGTGGTGCATGGCCGTTCT
Reaction size
200rxns
Product Resources
File Size: 269.55 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Entamoeba coli, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter sputorum models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Entamoeba coli facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter sputorum studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Entamoeba coli and elevate your work to new heights.