dPCR Microbial DNA Detection Assay for QnrC

GeneGlobe ID: DMA00564 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Resistance gene detection assay targeting the bacterial QnrC family quinolone resistance pentapeptide repeat protein gene
Product name​
QnrC
GeneGlobe Cat.No. (Assay ID)​
DMA00564
Target type​
Antibiotics Resistance
Target region​
Bacterial QnrC family quinolone resistance pentapeptide repeat protein gene
Target (NCBI taxonomy ID)​
Fluoroquinolone resistance
Template accession​
EU917444.1
Taxonomy​
Resistance Genes
Application field​
Fluoroquinolone Resistance
Antibiotic Resistance (AMR)
Multiple Drug Resistance
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
PvuII
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TGAAAATAAATGGGTAGGTGCAAGCCTGCAAGGGGCCTCTTTTAAAGAGTCAGACTTAAGTAGGGGATCATTTTCTGATGACTTTTGGGAGCAATGCAGAATTCAGGGGTGTGATCTCACTCAT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for QnrC, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Fluoroquinolone resistance models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for QnrC facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Fluoroquinolone resistance studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for QnrC and elevate your work to new heights.