dPCR Microbial DNA Detection Assay for Severe acute respiratory syndrome-related coronavirus

GeneGlobe ID: DMA00845 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: SARS, Human coronavirus (strain SARS), SARS-like coronavirus, SARS-related coronavirus
dPCR wet-lab verified
Product name​
Severe acute respiratory syndrome-related coronavirus
GeneGlobe Cat.No. (Assay ID)​
DMA00845
Target type​
Microbial Id
Target region​
ORF1b
Target (NCBI taxonomy ID)​
Severe acute respiratory syndrome-related coronavirus (694009)
HCoV-SARS
Human coronavirus (strain SARS)
SARS
SARS-like coronavirus
SARSr-CoV
SARSrCoV
SARS-related coronavirus
Template accession​
AY274119/NC_004718.3
Taxonomy​
Viruses
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TGATTCTTTCTGATGATGCCGTTGTGTGCTATAACAGTAACTATGCGGCTCAAGGTTTAGTAGCTAGCATTAAGAACTTTAAGGCAGTTCTTTATTATCAAAATAATGTGTTCATGTCTGAGGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCACGAATTTTGCTCACAGCATACAATGCTAGTTAAACAA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Informations techniques (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuels de kit (1)
Brochures et guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Severe acute respiratory syndrome-related coronavirus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Severe acute respiratory syndrome-related coronavirus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Severe acute respiratory syndrome-related coronavirus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Severe acute respiratory syndrome-related coronavirus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Severe acute respiratory syndrome-related coronavirus and elevate your work to new heights.