dPCR Microbial DNA Detection Assay for Salmonella enterica

GeneGlobe ID: DMA00291 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Salmonella enterica
GeneGlobe Cat.No. (Assay ID)​
DMA00291
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Salmonella enterica (28901)
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Template accession​
NC_011094.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Citrobacter amalonaticus (35703)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter ludwigii (299767)
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Application field​
Human Pathogens
Wastewater & Drinking Water Epidemiology
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TCAGATGTGCCCAGATGGGATTAGCTTGTTGGTGAGGTAACGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTACCCGCAGAAGAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 240.13 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Salmonella enterica, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Citrobacter amalonaticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Salmonella enterica facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Citrobacter amalonaticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Salmonella enterica and elevate your work to new heights.