dPCR Microbial DNA Detection Assay for Xylella fastidiosa

GeneGlobe ID: DMA00719 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
Alternative names of species: X. fastidiosa
dPCR wet-lab verified
Product name​
Xylella fastidiosa
GeneGlobe Cat.No. (Assay ID)​
DMA00719
Target type​
Microbial Id
Target region​
rimM
Target (NCBI taxonomy ID)​
Xylella fastidiosa (2371)
Template accession​
CP006740.1
Taxonomy​
Bacteria
Application field​
Plant Pathogens / Food Spoilage
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GGAGAACGTAATAACCACGGCTGGTAACGGAAGATCGCATCCCGTGGCTCAGTCCAAGACTCTATCTTGATTTCACCACGCAACCCGAAACCACCTACAAC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 97.48 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Xylella fastidiosa, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Xylella fastidiosa models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Xylella fastidiosa facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Xylella fastidiosa studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Xylella fastidiosa and elevate your work to new heights.