dPCR Microbial DNA Detection Assay for Lachancea thermotolerans

GeneGlobe ID: DMA00799 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Yeast detection assay
Alternative names of species: Zygosaccharomyces thermotolerans, Kluyveromyces thermotolerans
dPCR wet-lab validated
Product name​
Lachancea thermotolerans
GeneGlobe Cat.No. (Assay ID)​
DMA00799
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Lachancea thermotolerans (381046)
Kluyveromyces thermotolerans
Zygosaccharomyces thermotolerans
Template accession​
NR_111334.1
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TTTGTTAGAGCAGCCGGGAAGTTCAGAAGCCTGCGCTTGATTGCGCGGCCGATGATGCTTTCTGTTAACGACTGTCTCTCTACACACACACTGTGGAGTAATTTATTTTACAACGCTTCTTCTTTGGGCTTTACGGCCCAAGGGTTACAAACACAAACAACTATTGTATTTTAAACACTGTCAATTATTTTTCATTTTAGAAAAAAAATATTTAAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 90.88 KBLanguage: English

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Lachancea thermotolerans, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Lachancea thermotolerans models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Lachancea thermotolerans facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Lachancea thermotolerans studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Lachancea thermotolerans and elevate your work to new heights.