dPCR Microbial DNA Detection Assay for Enterobius vermicularis

GeneGlobe ID: DMA00366 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Metazoa detection assay targeting the 5S ribosomal RNA gene
Product name​
Enterobius vermicularis
GeneGlobe Cat.No. (Assay ID)​
DMA00366
Target type​
Microbial Id
Target region​
5S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Enterobius vermicularis (51028)
human pinworm
Template accession​
AY682469.2
Taxonomy​
Invertebrates
Application field​
Human Pathogens
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TGCTCTACACTATTGCAGAGCTTTTCCAAAATTTATTTCCAAGCCACAGACTCACTGATGTTCATGTCTGAGCCGGAACGAGAAATTACCTCAAACTTGGGTAATTAAACCAACGATCATTGCCACTGACGTTTAATATAATCGGCAAACGAGCAATTCTGGCCGGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
기술 정보 (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
키트 안내서 (1)
브로셔 및 가이드 (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Enterobius vermicularis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Enterobius vermicularis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Enterobius vermicularis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Enterobius vermicularis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Enterobius vermicularis and elevate your work to new heights.