dPCR Microbial DNA Detection Assay for Escherichia coli

GeneGlobe ID: DMA00140 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Escherichia coli
GeneGlobe Cat.No. (Assay ID)​
DMA00140
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Escherichia coli (562)
Bacillus coli
Bacterium coli commune
Bacterium coli
E. coli
Enterococcus coli
Escherichia/Shigella coli
Template accession​
NC_008258.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Shigella dysenteriae (622)
Bacillus dysenteriae
Bacillus dysentericus
Bacillus shigae
Eberthella dysenteriae
Escherichia/Shigella dysenteriae
Shigella shigae
Shigella boydii (621)
Escherichia fergusonii (564)
CDC Enteric Group 10
Escherichia/Shigella fergusonii
Serratia marcescens (615)
Bacillus marcescens
Serratia marcescens subsp. marcescens
Serratia marcescens subsp. sakuensis
Shigella sonnei (624)
Bacterium sonnei
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Shigella flexneri (623)
Escherichia flexneri
Escherichia/Shigella flexneri
Shigella paradysenteriae
Klebsiella aerogenes (548)
Aerobacter aerogenes
Enterobacter aerogenes
Klebsiella mobilis
Escherichia albertii (208962)
Escherichia/Shigella albertii
Application field​
Human Microbiome
Wastewater & Drinking Water Epidemiology
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 266.99 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Escherichia coli, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Shigella dysenteriae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Escherichia coli facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Shigella dysenteriae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Escherichia coli and elevate your work to new heights.