GeneGlobe ID: DMA00359 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Giardia intestinalis
Product Specification
Metamonada detection assay targeting the 18S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Giardia intestinalis
GeneGlobe Cat.No. (Assay ID)
DMA00359
Target type
Microbial Id
Target region
18S ribosomal RNA gene
Target (NCBI taxonomy ID)
Giardia intestinalis (5741)
Giardia duodenalis
Giardia lamblia
Lamblia intestinalis
Giardia duodenalis
Giardia lamblia
Lamblia intestinalis
Template accession
KF843922.1
Taxonomy
Invertebrates
Application field
Environmental Microbes
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - ROX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
ACCCGGGACGCGGCGGACGGCTCAGGACAACGGTTGCACCCCCCGCGGCGGTCCCTGCTAGCCGGACACCGCTGGCAACCCGGCGCCAAGACG
Reaction size
200rxns
Product Resources
File Size: 203.86 KBLanguage: English
Resources
Available Product Catalog (2)
Kurzprotokolle (1)
Anwendungshinweise (2)
Technische Informationen (1)
Kit-Handbücher (1)
Wissenschaftliche Poster (1)
Broschüren und Leitfäden (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Application Notes (2)
Scientific Posters (1)
Technical Information (1)
Kit Handbooks (1)
Quick-Start Protocols (1)
Introducing the dPCR Microbial DNA Detection Assay for Giardia intestinalis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Giardia intestinalis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Giardia intestinalis and elevate your work to new heights.