dPCR Microbial DNA Detection Assay for Plasmodium malariae

GeneGlobe ID: DMA00773 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Parasite detection assay
Alternative names of species: P. malariae
dPCR wet-lab validated
Product name​
Plasmodium malariae
GeneGlobe Cat.No. (Assay ID)​
DMA00773
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Plasmodium malariae (5858)
Template accession​
MF693442.1
Taxonomy​
Invertebrates
Application field​
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TATTATACAATTTAAAATGTTATTTGGTGCAAGAGAATATTCTGTTCCAATTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATTGGATGTCAATTACCACAAGAAATTTTCATTTTATATGGTCGTCTATTTATTATATCATTCTTTTCTAGTGGTTTATTTGCACTTGTTCATTATAAAAGAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 89.21 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Plasmodium malariae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Plasmodium malariae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Plasmodium malariae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Plasmodium malariae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Plasmodium malariae and elevate your work to new heights.